Glyma02g00780 - SoyBase

SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma02g00780

Feature Type:	gene_model
Chromosome:	Gm02
Start:	574680
stop:	579321
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma02g00780

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G04420	AT	Annotation by Michelle Graham. TAIR10: NAD(P)-linked oxidoreductase superfamily protein \| chr1:1191634-1193699 FORWARD LENGTH=412	SoyBase	E_val: 0	ISS
GO:0019288	GO-bp	Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0009570	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma	SoyBase	N/A	ISS
GO:0009941	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope	SoyBase	N/A	ISS
GO:0004033	GO-mf	Annotation by Michelle Graham. GO Molecular Function: aldo-keto reductase (NADP) activity	SoyBase	N/A	ISS
KOG1575	KOG	Voltage-gated shaker-like K+ channel, subunit beta/KCNAB	JGI		ISS
PTHR11732	Panther	ALDO/KETO REDUCTASE	JGI		ISS
PTHR11732:SF15	Panther	GLUCOSE--FRUCTOSE OXIDOREDUCTASE	JGI		ISS
PF00248	PFAM	Aldo/keto reductase family	JGI		ISS
UniRef100_G7I4M8	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Aldo-keto reductase n=1 Tax=Medicago truncatula RepID=G7I4M8_MEDTR	SoyBase	E_val: 0	ISS
UniRef100_I1JB81	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JB81_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma02g00780

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma02g00780 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.02g005200	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma02g00780

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma02g00780

Limit To All Plant Sequences

>Glyma02g00780.1   sequence type=CDS   gene model=Glyma02g00780   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTATCTCTGTGTTCCTTCACTTCTTTTGCATGTGACAACCTTTCTCTTTCTCTTTCTCAGTCTCTCAAACCGTCATCATTGCCTCTCATTCACTCTTTCACACTTCCAAGAAACACTATCAGGAAGAAGAACGGTGCTAGTGTGAGGCCTCTGTTCTGTGCCCTCAACAACAATAACAACAACACTGCCTTGCAGTACAGAACCCTCGGCGACTCCGACCTCAACATCAGCGAAATCACTCTTGGTACTATGACCTTTGGGGAGCAAAACACTGAGAAAGAAGCTCACGACATTCTTAATTATGCATTCGACCGTGGAATTAACGCTCTCGACACTGCTGAGGCCTACCCAATTCCAATGAAGAAAGAGACACAAGGAAGCACTGATCTCTATATTGGTAGCTGGCTCAAGTCTCAACCTCGTGACAAGATTATTTTGGCTACCAAAGTATGTGGTTATTCTGAGAGGTCAAGTTACTTGCGTGAGAATGCAAATGTTTTGCGGGTTGATGCTGCAAATATCAAAGAAAGTGTAGAGAAAAGCCTTAAGCGCCTCGACACTGATTATATTGATTTGCTGCAAATTCACTGGCCAGATCGATATGTTGCATTGTTTGGCGAGTTTTCCTATGATTATTCAAAATGGAGATCCAGTGTGCCATTTGTTGAGCAATTGCAAGCTTTCCAAGAACTTATCAATGAGGGAAAGGTACGCTACATAGGTGTTTCAAATGAGACTTCATATGGAGTGATGGAGTTTGTTCATGCATCGAAAGTTGAAGGCCTTCCAAAGATTGTCAGTATCCAAAACAGCTACAGCTTGCTTGTTAGATGTCGTTTTGAAGTTGATCTTGTGGAAGTTTGCCATCCAAAGAATTGCAATATTGGCTTACTAGCCTATTCCCCACTTGGAGGTGGATCACTCACAGGAAAATATATAGATATAAATTCTGAAGCTGCAAAAAGTGGAAGGCTTAACCTCTTCCCTGGTTACATGGAAAGATATAACAAATCAGTGGCACGGGAAGCTACTATTAAGTATCTTGAGTTGGCCAAGAAGCATGGGCTAACTCCTGTTCAACTTGCACTTGGATTTGCAAGAGATCGTCCATTCATGACAAGTTCAATAATTGGTGCAACCTCTGTGGACCAGCTAAAAGAAGATATTGATGCTTTCACAACAACTGAGAGACCTTTACCAGCAGAAGTCATGGCAGATATTGAAGCTATCTTCAAGAGATACAAAGATCCTGCCATTCTTTAA

Predicted protein sequences of Glyma02g00780

Limit To All Plant Sequences

>Glyma02g00780.1   sequence type=predicted peptide   gene model=Glyma02g00780   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVSLCSFTSFACDNLSLSLSQSLKPSSLPLIHSFTLPRNTIRKKNGASVRPLFCALNNNNNNTALQYRTLGDSDLNISEITLGTMTFGEQNTEKEAHDILNYAFDRGINALDTAEAYPIPMKKETQGSTDLYIGSWLKSQPRDKIILATKVCGYSERSSYLRENANVLRVDAANIKESVEKSLKRLDTDYIDLLQIHWPDRYVALFGEFSYDYSKWRSSVPFVEQLQAFQELINEGKVRYIGVSNETSYGVMEFVHASKVEGLPKIVSIQNSYSLLVRCRFEVDLVEVCHPKNCNIGLLAYSPLGGGSLTGKYIDINSEAAKSGRLNLFPGYMERYNKSVAREATIKYLELAKKHGLTPVQLALGFARDRPFMTSSIIGATSVDQLKEDIDAFTTTERPLPAEVMADIEAIFKRYKDPAIL*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain